Introductions

Website Overview

Key Evolution Resources

Tree Thinking with the Clade Race and Pipecleaners

An activity about tree thinking and how it is possible to use character traits to reconstruct evolution. Great for all ages!

Basic Tree Thinking Assessment
A short quiz (with answers) to test your tree thinking abilities.
b
b

Increasing Opportunities for Inquiry

Who’s teaching? Who’s learning?

 

Mystery Tubes:

  • Is there always confirmation of a right answer?

 

Number Patterns:

How is this like doing science?

Start of Part 2

 

***Review of SWAG:  Materials for participants***

PowerPoint:  Labs

Lab 3:  Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST

Phylogenetics: Students learn how to build and interpret phylogenetic trees
  • Interpret a tree
  • Build a tree
DNA alignment: Students use BLAST to align sequences to
  • Assign a “new species” to a phylogenetic tree
  • Explore genes of their choice
    • –Actin example
    • –Pre-run BLAST examples
    • –Suggested genes to explore
Big Idea #1:  The Process of Evolution  

Supporting Student Objectives     Lab Book  AP Framework  External

1. The student is able to evaluate data-based evidence that describes evolutionary changes between the genetic makeup of populations over time.

Enduring Understanding 1. A: Evolution is change in the genetic makeup of a population over time. 

Scientific Practice 5.  The student can perform data analysis and evaluation of evidence.

    • Independent Investigations
    • Donor’s Dilemma (Epidemiology of West Nile Virus)
    • Witness for the Whales  (Cetacean Forensics)

2. The student is able to evaluate evidence provided by data from multiple scientific disciplines that support biological evolution.

Essential Knowledge 1.A.4: Biological evolution is supported by scientific evidence from many disciplines including mathematics.

Scientific Practice 5.  The student can perform data analysis and evaluation of evidence.

        • Reading Trees(morphological data) and BLAST (molecular data)
        • Donor’s Dilemma (molecular data)
        • Witness for the Whales (molecular data)
        • Whippo Problem Space (morphological data and molecular data)
        • Evolution and Medicine (molecular data)
3. The student is able to construct and/or justify mathematical models, diagrams, or simulations that represent processes of biological evolution.
Essential Knowledge 1.A.4: Biological evolution is supported by scientific evidence from many disciplines including mathematics.
Science Practice 1: The student can use representations and models to communicate scientific phenomena and solve scientific problems.
        • Reading Trees(morphological data) and BLAST (molecular data)
        • Potential Challenge:  Aligning molecular sequences to infer relatedness
        • Donor’s Dilemma (molecular data) : Origin of WNV
        • Witness for the Whales (molecular data): Identity of Unknown Cetacean
4. The student is able create a phylogenetic tree or simple cladogram that correctly represents evolutionary history and speciation from a provided data set.
Enduring Understanding 1.B: Organisms are linked by lines of descent from common ancestry.  
Essential Knowledge 1.B.2 : Phylogenetic trees and cladograms are graphical representations (model) of evolutionary history that can be tested.
Science Practice 1: The student can use representations and models to communicate scientific phenomena and solve scientific problems.
          • Getting Started: Prelab Assessment
          • Tree Thinkng: Dendrogrammaceae Activity
5. The student is able to construct scientific explanations that use the structures and mechanisms of DNA and RNA to support the claim that DNA and, in some cases, RNA are the primary sources of heritable information.
Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes.
Enduring Understanding 3.A: Heritable information provides for continuity of Life.
Essential Knowledge 3. A. 1: DNA, and in some case RNA, is the primary source of heritable information.
Scientific Practice 6: The student can work with scientific explanations and theories.
          • Independent Investigations (molecular data)
          • Donor’s Dilemma (molecular data – RNA)
          • Witness for the Whales (molecular data – DNA, proteins)

Adding More Inquiry Experiences to the Lab Investigation

Additional Resources:  Reading Trees

Which animals share the salamander's most recent common ancestor?

Imagine the tree as a mobile. Will the relationships change between the animals if they move around in a breeze?

Additional Resources: Using Molecular Sequences to Determine Relatedness

Case 1:  Donor’s Dilemma

ClustalW2 – Select Nucleic and then file for multiple alignment. Submit. Save alignment file. Go to Phylogeny and select ClustalW2. Select alignment file then submit to generate cladogram.

Case 2:  Tree Thinking

> Unknown 1
GAAAATATATATTGTACAATAACCACAAGGCCACAGTATTATGTCCGTATTAAAAATAAC
TTATTTTATTGCATACTGTTATGTAACTTGTGCATGTATGTACTCCCACATAACCCATAG
TAGTTAGTATTCCCCTGTGAATATGTATATGTACACATACTATGTATAATTGTGCATTCA
ATTATCTTCACTACGGAAGTTAAAGCCCGTATTAAATTTTATTAATTTTACATATTACAT
AATATTTATTAATAGTACAATAGTACATGTTCTTATGCATCCTCAGGTCATTCTAGACGG
AATGACTCTTATGGCCGCTCCATTAGATCACGAGCTTAATCAGCATGCCGCGTGAAACCA
GCAACCCGCTCGGCAGGGATCCCTCTTCTCGCACCGGGCCCATCAATCGTGGGGGTAGCT
ATTTAATGATCTTTATAAGACATCTGGTTCTTACTTCAGGACCATATTAACTTAAAATCG

2 Responses to Inquiry Labs and Resources

  1. Allison Fuelling says:

    Encyclopedia of Marine Mammals

    GenBank

    Endangered Species List

  2. Ethel Stanley says:

    These are excellent resources for the “Witness for the Whales” activities. Thanks, Allison!