Sequence alignment

Consensus key (see documentation for details)

* - single, fully conserved residue

  - no consensus

 

 

CLUSTAL W (1.8) multiple sequence alignment

 

 

MMU08337      ------------------------------------------------------------

HSGDF5        CCATGGCCTCGAAAGGGCAGCGGTGATTTTTTTCACATAAATATATCGCACTTAAATGAG

AF123389      ------------------------------------------------------------

 

 

MMU08337      ------------------------------------------------------------

HSGDF5        TTTAGACAGCATGACATCAGAGAGTAATTAAATTGGTTTGGGTTGGAATTCCGTTTCCAA

AF123389      ------------------------------------------------------------

 

 

MMU08337      ------------------------------------------------------------

HSGDF5        TTCCTGAGTTCAGGTTTGTAAAAGATTTTTCTGAGCACCTGCAGGCCTGTGAGTGTGTGT

AF123389      ------------------------------------------------------------

 

 

MMU08337      ------------------------------------------------------------

HSGDF5        GTGTGTGTGTGTGTGTGTGTGTGTGTGTGAAGTATTTTCACTGGAAAGGATTCAAAACTA

AF123389      ------------------------------------------------------------

 

 

MMU08337      ------------------------------------------------------------

HSGDF5        GGGGGAAAAAAAAACTGGAGCACACAGGCAGCATTACGCCATTCTTCCTTCTTGGAAAAA

AF123389      ------------------------------------------------------------

 

 

MMU08337      ------------------------TTCAAGCCCTCAGTCAGTTGTGCGGGAGAAAGGGGG

HSGDF5        TCCCTCAGCCTTATACAAGCCTCCTTCAAGCCCTCAGTCAGTTGTGCAGGAGAAAGGGGG

AF123389      ------------------------------------------------------------

 

 

MMU08337      CGGTCGGCTTTCTCCTTTCAAGAACGAGTTATTTTCAGCTGCTGACTGGAGACGGTGCAC

HSGDF5        CGGTTGGCTTTCTCCTTTCAAGAACGAGTTATTTTCAGCTGCTGACTGGAGACGGTGCAC

AF123389      ------------------------------------------------------------

 

 

MMU08337      GTCTGGACACGGGAGCACTTCCACTATGGGACTGGATACAGACACACGCCCGGCGGACTT

HSGDF5        GTCTGGATACGAGAGCATTTCCACTATGGGACTGGATACAAACACACACCCGGCAGACTT

AF123389      ------------------------------------------------------------

 

 

MMU08337      CAAGACACTCAGACTGAGGAGAAAGCCCTGCCTGCTGCTGCTGCTGCTGCTGCTGCCACC

HSGDF5        CAAGAGTCTCAGACTGAGGAGAAAGCCTTTCCTTCTGCTGCTACTGCTGCTGC-----C-

AF123389      ------------------------------------------------------------

 

 

MMU08337      GCTGCCTCTGAAGACCCACTCCTTTCATGGTTTTTCCTGCCAAGCCAGAGGCACCTTCGC

HSGDF5        GCTGCTTTTGAAAGTCCACTCCTTTCATGGTTTTTCCTGCCAAACCAGAGGCACCTTTGC

AF123389      ------------------------------------------------------------

 

 

MMU08337      TGCTACGGCCTTTCTCTGTGGTGTCATTCAGCGGCTGGCCAGAGGATGAGACTCCCCAAA

HSGDF5        TGCTGCCGCTGTTCTCTTTGGTGTCATTCAGCGGCTGGCCAGAGGATGAGACTCCCCAAA

AF123389      ---------------------------------------------ATGAAAATCCTGCAT

                                                           **** * ***   *

 

MMU08337      CTCCTCACTCTTTTGCTGTGGCACCTGGCTTGGCTGGACCTGGAACTCATCTGCACTGTG

HSGDF5        CTCCTCACTTTCTTGCTTTGGTACCTGGCTTGGCTGGACCTGGAATTCATCTGCACTGTG

AF123389      TTTCTCACTTTACTGCTTTGGCATTTGACTTGGCTGTCTCTGGATCGTGTTCCTGGAGCA

               * ****** *  **** *** *  ** ********   *****     *       * 

 

MMU08337      CTGGGTGCCCCTGACTTAGGACAGAGAACCCCAGGGGCCAAGCCAGGGTTGACCAAAGCG

HSGDF5        TTGGGTGCCCCTGACTTGGGCCAGAGACCCCAGGGGACCAGGCCAGGATTGGCCAAAGCA

AF123389      CTGAGTAACTCCGAAGCAGGCCAGAGTAATCCAGGGTCTAAAACAGATCTGTTAAAAGCA

               ** **  * * **    ** *****    *  *** * *   ***   **   *****

 

MMU08337      GAGGCCAAGGAGAGGCCACCCCTGGCCAGG---AATGTCTTTAGGCCAGGGGGTCATATC

HSGDF5        GAGGCCAAGGAGAGGCCCCCCCTGGCCCGG---AACGTCTTCAGGCCAGGGGGTCACAGC

AF123389      GAAGGAAAAGAGAGGACTGCCTCAGCACGGTCGGGCGCGCCGCGGGCTGCGAACCATGGA

              ** *  ** ****** *  **   **  **      *      ** * * *   **   

 

MMU08337      TATGGTGTGGGGGCCACCAATGCCA------GGGCCAAGGGAAGCTCTGGGCAGACA---

HSGDF5        TATGGTGGGGGGGCCACCAATGCCAATGCCAGGGCAAAGGGAGGCACCGGGCAGACAGGA

AF123389      TTTAGCACCGGGACCTCGAAGGCGA------GGGCTAAAAGCAACGCTGCTCAGGCTGGA

              * * *    *** ** * ** ** *      **** **  *   * * *  *** *   

 

MMU08337      ---------CAGGCCAAGAAGGATGAACCCAGAAAGATGCCCCCCAGATCCGGTGGCTCT

HSGDF5        GGCCTGACACAGCCCAAGAAGGATGAACCCAAAAAGCTGCCCCCCAGACCGGGCGGCCCT

AF123389      GCTCTG---CTGGCCAAGAACGATGAATCACAGAGGGTTCTTTCAAGAACAGCAGTCACA

                       * * ******* ****** *    * * * *   * *** * *  * * *

 

MMU08337      GAAACCAAGCCAGGACCCTCTTCCCAGACTAGACAGGCTGCAGCCCGGACTGTAACCCCA

HSGDF5        GAACCCAAGCCAGGACACCCTCCCCAAACAAGGCAGGCTACAGCCCGGACTGTGACCCCA

AF123389      GAGGCAAAGGTAGGACA---TCTCCCGAGCAGACCTTCTGCAGTAAGGACGGTGACTCCA

              **  * ***  *****    *  **  *  ** *   ** ***   **** ** ** ***

 

MMU08337      AAAGGACAGCTTCCTGGGGGCAAAGCATCTTCAAAAGCA------------GGATCTGCC

HSGDF5        AAAGGACAGCTTCCCGGAGGCAAGGCACCCCCAAAAGCA------------GGATCTGTC

AF123389      AAGGTCCCAAATCTTGGCAGCAAGGCGGCTCTGAAGAAAACTGGCACGGGCGGCACTGAT

              ** *  *    **  **  **** **  *    **   *            **  *** 

 

MMU08337      CCCAGCTCCTTCCTGCTGAAGAAGACCAGGGAGCCTGGGACCCCTCGAGAGCCCAAGGAG

HSGDF5        CCCAGCTCCTTCCTGCTGAAGAAGGCCAGGGAGCCCGGGCCCCCACGAGAGCCCAAGGAG

AF123389      GCCAGCTCCTTCAAAACGAAGAAGACTAAAGAGCCTGTGACCCAAAGGGAAGCTAAGGAA

               ***********     ******* * *  ***** * * ***   * **  * *****

 

MMU08337      CCGTTCCGCCCGCCCCCCATCACACCCCACGAATACATGCTCTCCCTGTACAGGACGCTG

HSGDF5        CCGTTTCGCCCACCCCCCATCACACCCCACGAGTACATGCTCTCGCTGTACAGGACGCTG

AF123389      ACCTTCAGCAGGCCCCCTATAACGCCACATGAATACATGCTCTCTTTGTACAGGACTCTC

               * **  **   ***** ** ** ** ** ** ***********  ********** **

 

MMU08337      TCCGATGCTGACAGAAAGGGAGGTAACAGCAGCGTGAAGTTGGAGGCTGGCCTGGCCAAC

HSGDF5        TCCGATGCTGACAGAAAGGGAGGCAACAGCAGCGTGAAGTTGGAGGCTGGCCTGGCCAAC

AF123389      TCAGATGCAGAAAGAAAAGGTGTTAATGGAAGTGTAAAACTGGAGGCTGGACTCGCCAAT

              ** ***** ** ***** ** *  **  * ** ** **  ********** ** *****

 

MMU08337      ACCATCACCAGCTTTATTGACAAAGGGCAAGATGACCGAGGCCCTGCGGTCAGGAAGCAG

HSGDF5        ACCATCACCAGCTTTATTGACAAAGGGCAAGATGACCGAGGTCCCGTGGTCAGGAAGCAG

AF123389      ACAATAACCAGCTTTATAGACAAGGGACAAGATGAGCGAGCGCCAACCATAAGAAAACAA

              ** ** *********** ***** ** ******** ****  **     * ** ** **

 

MMU08337      AGGTACGTGTTTGACATCAGTGCCTTGGAGAAGGATGGGCTGTTGGGGGCTGAACTGCGG

HSGDF5        AGGTACGTGTTTGACATTAGTGCCCTGGAGAAGGATGGGCTGCTGGGGGCCGAGCTGCGG

AF123389      AAATATATTTTTGACATCAGTGCATTAGAAAAAGATGGCCTGCTGGTAGCAGAGCTTCGA

              *  **  * ******** *****  * ** ** ***** *** ***  ** ** ** **

 

MMU08337      ATCTTACGGAAGAAGCCCTTGGACGTGGCCAAGCCAGCGGTCCCCAGTAGCGGGCGGGTT

HSGDF5        ATCTTGCGGAAGAAGCCCTCGGACACGGCCAAGCCAGCGGCCCCCGGAGGCGGGCGGGCT

AF123389      ATACTGAGGAAAAATCCTTCTGATACGTGGAAGTCT-CATTCTTC--T---GGAAAAACT

              **  *  **** ** ** *  **   *   *** *  *   *  *      **      *

 

MMU08337      GCCCAACTGAAGCTGTCCAGCTGCCCCAGCGGCCGGCAGCCGGCAGCCTTGCTGGATGTG

HSGDF5        GCCCAGCTGAAGCTGTCCAGCTGCCCCAGCGGCCGGCAGCCGGCCTCCTTGCTGGATGTG

AF123389      TCCCAGGTGAAATTATTTAGTTGCTCTACCAACAGACAAGCAGCAACACTGCTGGACTCT

               ****  ****  * *  ** *** * * *  * * **  * **  *  *******   

 

MMU08337               CGCTCCGTGCCAGGCCTGGATGGATCTGGCTGGGAGGTGTTCGACATCTGGAAGCTCTTC

HSGDF5        CGCTCCGTGCCAGGCCTGGACGGATCTGGCTGGGAGGTGTTCGACATCTGGAAGCTCTTC

AF123389      CGTACCGTCAGTATCACGGACACACCAAAATGGGAAGTGTTTGACATCTGGAAGCTTTTT

              **  ****      *  ***   * *    ***** ***** ************** **

 

MMU08337      CGAAATTTTAAGAACTCAGCGCAGCTGTGCCTGGAGCTGGAGGCCTGGGAACGGGGCCGG

HSGDF5        CGAAACTTTAAGAACTCGGCCCAGCTGTGCCTGGAGCTGGAGGCCTGGGAACGGGGCAGG

AF123389      AGGAACTTTAAAAACTTGGTTAACTTGTGTTTCGAACTGGAAACTTTTGACAGGGGGAGA

               * ** ***** ****  *   *  ****  * ** *****  * *  **  ****  *

 

MMU08337      GCCGTGGACCTCCGTGGCCTGGGCTTTGAACGCACTGCCCGACAGGTCCACGAGAAAGCC

HSGDF5        GCCGTGGACCTCCGTGGCCTGGGCTTCGACCGCGCCGCCCGGCAGGTCCACGAGAAGGCC

AF123389      GCGGTTGATCTCAGGACTGTGGGATTTAACAGAACGGGAAGACAGGTCAACGAAAAGGCT

              ** ** ** *** *     **** **  *  *  * *   * ****** **** ** **

 

MMU08337      TTGTTCCTAGTGTTTGGTCGTACCAAGAAACGGGACCTGTTCTTTAATGAGATTAAGGCC

HSGDF5        CTGTTCCTGGTGTTTGGCCGCACCAAGAAACGGGACCTGTTCTTTAATGAGATTAAGGCC

AF123389      CTCTTCTTGGTATTTGGGAGGACAAAGAAAAGGGACTTATTTTTCAATGAAATCAAAGCT

               * *** * ** *****  * ** ****** ***** * ** ** ***** ** ** **

 

MMU08337      CGCTCTGGCCAGGATGACAAGACTGTGTATGAATATTTGTTCAGCCAGCGGCGGAAACGC

HSGDF5        CGCTCTGGCCAGGACGATAAGACCGTGTATGAGTACCTGTTCAGCCAGCGGCGAAAACGG

AF123389      AGATCCGGCCAGGACGACAAAACCGTGTATGAGTACTTATTCAATCAGAGGCGGAAGAGA

               * ** ******** ** ** ** ******** **  * ****  *** **** **  *

 

MMU08337      CGGGCCCCATTGGCCAATCGCCAGGGCAAGCGACCCAGCAAGAACCTCAAGGCTCGCTGC

HSGDF5        CGGGCCCCACTGGCCACTCGCCAGGGCAAGCGACCCAGCAAGAACCTTAAGGCTCGCTGC

AF123389      AGAGCTCCTCTGGCAACACGCCAAGGGAAGAGGCCCAGTAAGAACCTGAAGCCAAGGTGT

               * ** **  **** *  ***** ** *** * ***** ******** *** *  * **

 

MMU08337      AGTCGCAAGGCCTTGCATGTCAACTTCAAGGACATGGGCTGGGACGACTGGATCATCGCA

HSGDF5        AGTCGGAAGGCACTGCATGTCAACTTCAAGGACATGGGCTGGGACGACTGGATCATCGCA

AF123389      AGCAGAAAAGCCCTCCATGTGAATTTTAAGGACATGGGCTGGGATGACTGGATAATAGCA

              **  * ** **  * ***** ** ** ***************** ******** ** ***

 

MMU08337      CCTCTTGAGTATGAGGCCTTCCACTGCGAAGGACTGTGTGAGTTCCCCTTGCGCTCCCAC

HSGDF5        CCCCTTGAGTACGAGGCTTTCCACTGCGAGGGGCTGTGCGAGTTCCCATTGCGCTCCCAC

AF123389      CCCCTGGAATACGAAGCGTATCACTGCGAAGGTCTGTGTGAGTTCCCCCTCCGATCCCAC

              ** ** ** ** ** ** *  ******** ** ***** ********  * ** ******

 

MMU08337              T TGGAGCCCACAAACCACGCAGTCATTCAGACCCTAATGAACTCTATGGACCCTGAATCC

HSGDF5        CTGGAGCCCACGAATCATGCAGTCATCCAGACCCTGATGAACTCCATGGACCCCGAGTCC

AF123389      CTGGAGCCCACCAATCACGCCGTTATCCAAACTTTAATGAACTCAATGGACCCCGAATCA

               ********** ** ** ** ** ** ** **  * ******** ******** ** **

 

MMU08337      ACACCACCCACTTGTTGTGTGCCTACACGGCTGAGTCCTATTAGCATCCTCTTCATCGAC

HSGDF5        ACACCACCCACCTGCTGTGTGCCCACGCGGCTGAGTCCCATCAGCATCCTCTTCATTGAC

AF123389      ACGCCTCCAACTTGCTGTGTCCCAACCAGGCTGAGTCCTATCAGCATTCTCTTCATTGAC

              ** ** ** ** ** ***** ** **  ********** ** ***** ******** ***

 

MMU08337      TCTGCCAACAACGTGGTGTATAAACAGTACGAGGACATGGTCGTGGAATCTTGTGGCTGC

HSGDF5        TCTGCCAACAACGTGGTGTATAAGCAGTATGAGGACATGGTCGTGGAGTCGTGTGGCTGC

AF123389      TCTGCAAACAATGTGGTCTACAAGCAGTACGAGGACATGGTGGTGGAGTCGTGTGGCTGC

              ***** ***** ***** ** ** ***** *********** ***** ** *********

 

MMU08337      AGGTAGCAGCACCGGCCCACCTGTCTTCCAGGGTGGCACATCCAGAGACTACCCCCTCTA

HSGDF5        AGGTAGCAGCACTGGCCC-TCTGTCTTCCTGGGTGGCACATCCCAAGAGC-CCCTTCCTG

AF123389      AGGTAGCAGAACAGTTGCTCATGT------GAATGGTGTT--------------------

              ********* ** *   *   ***      *  ***                       

 

MMU08337      CAGGTTCCTGGAGTAACAGAGAGCCTGTGAAGCTGCTGCCCGAAGTTTCCTGGCAGCCTG

HSGDF5        CA--CTCCTGGAATCACAGAGGGGTCAGGAAGCTG-TGGCAGGAGCATCTACACAGCTTG

AF123389      ------------------------------------------------------------

 

 

MMU08337      CAGGAAAGAGTTCTC-----AGCAGGCTTACTCTCTGGATGTGATCTGGACTAAAG----

HSGDF5        GGTGAAAGGGGATTCCAATAAGCTTGCTCGCTCTCTGAGTGTGACTTGGGCTAAAGGCCC

AF123389      ------------------------------------------------------------

 

 

MMU08337      ------------AGATCACCTT--CTGAAGATTCCTGCCCAAG----GAACAGACTCTGA

HSGDF5        CCTTTTATCCACAAGTTCCCCTGGCTGAGGATTGCTGCCCGTCTGCTGATGTGACCAGTG

AF123389      ------------------------------------------------------------

 

 

MMU08337      GTGGGCCTGGGGCTCAGGAAAGGTGTTCTTAATGAGATTCAGTTC------ACCATCTCT

HSGDF5        GCAGGCACAGGTCCAGGGAGACAGACTCTGAATGGGACTGAGTCCCAGGAAACAGTGCTT

AF123389      ------------------------------------------------------------

 

 

MMU08337      CCTGCCGGGGCCGGAGACCTTCATTTCTCTCCAGACTCTCCAGAGAAGTTGTAGCTATAT

HSGDF5        TCCGATGAGACTC-AGCCCACCATTTCTCCTCACCTGGGCCTTCTCAGCCTCTGGACTCT

AF123389      ------------------------------------------------------------

 

 

MMU08337      CCTAAGCTCTTTAAGGGAGAGCTGT---------CTCCTCCTTGAATCACCTTTGTGCCT

HSGDF5        CCTAAGCACCTCTCAGGAGAGCCACAGGTGCCACTGCCTCCTCAAATCACATTTGTGCCT

AF123389      ------------------------------------------------------------

 

 

MMU08337      GGTGACTTTCTGCCAC-GAGATGTTCATTACAGGGGCTGGGCAAAGAAGGG---GAAAGG

HSGDF5        GGTGACTTCCTGTCCCTGGGACAGTTGAGAAGCTGACTGGGCAAGAGTGGGAGAGAAGAG

AF123389      ------------------------------------------------------------

 

 

MMU08337      GCTTGGGCAGGGGTGAAGA-GAAGAGTATGAGCCTAATTAGACTGTTAGATTAAAATGTA

HSGDF5        GAGAGGGCTTGGATAGAGTTGAGGAGTGTGAGGCTG-TTAGACTGTTAGATTTAAATGTA

AF123389      ------------------------------------------------------------

 

 

MMU08337      CATCGATGACATAAAAGCTGAATCTTCATGGCT

HSGDF5        TATTGATGAGATAAAAAGCAAAACT--GTGCCT

AF123389      ---------------------------------

 

 

Clustal W options and diagnostic messages

Alignment type: Nucleic                 Alignment order: aligned               

 

                    Pairwise alignment parameters

 

Method: accurate                       

Matrix: IUB                            

Gap open pentalty: 15.00                Gap extension pentalty: 6.66           

 

                    Multiple alignment parameters

 

Matrix: IUB                             Negative matrix?: no                   

Gap open pentalty: 15.00                Gap extension pentalty: 6.66           

% identity for delay: 30                DNA transitions weighting: 0.5         

 

 

 

 

 CLUSTAL W (1.8) Multiple Sequence Alignments