Primer Design Exercise 1

Design primers 15-25 bp long that will amplify both of the sequences below.

You may wish to use an Alignment program to identify conserved regions in both sequences.

These sites would be good targets for PCR primers to bind to both sequences.

Recall that the two primers need to bind to the target DNA such that the free 3« ends of each primer point towards each other.

You may wish to review the rules used design primers.

After you have identified the sequence of your primers, check the primers with the programs used to calculate melting temperature (Tm) and the formation of primer dimers.

If the Tm is less than 55oC or bad hairpins or dimers form, try another region of sequence. A link to one possible answer is given at the bottom of the page.

>Paddlefish

CCTTGGCCTCTGCCTAATCACACAGATTCTAACAGGATTATTTCTCGCAATACACTACACAGCTGACA TCTCAACAGCCTTCTCCTCCGTCGCCCACATCTGTCGAGATGTTAACTACGGATGACTAATTCGAAAC ATTCATGCAAACGGAGCCTCCTTTTTCTTCATCTGCCTCTACCTTCACGTAGCCCGAGGCATATACTA TGGCTCATACCTCTACAAAGAAACCTGAAACATCGGAGTAGTTCTCCTACTCCTAACTATAATAACCG CCTTCGTAGGATATGTGCTCCCATGAGGACAGATATCCTTCTGAGGAGCCACCGTAATTACCAACCTT CTTTCCGCCTTCCCCTACATCGGGGACACCCTAGTACAATGAATCTGAGGTGGTTTCTCAGTAGACAA CGCCACCCTAACC

>Shovenose Sturgeon

CCTAGGCCTCTGCCTTATTACACAAATCTTAACAGGACTATTTCTTGCAATACACTACACAGCTGACA TTTCAACAGCCTTCTCCTCCGTCGCCCACATCTGCCGAGACGTAAACTACGGGTGACTAATCCGAAAC GTCCACGCAAATGGCGCCTCCTTCTTCTTTATCTGCTTGTACCTTCACGTCGCACGAGGTATATACTA CGGCTCCTACCTCCAAAAAGAAACCTGAAACATCGGAGTAGTCCTCTTACTCCTCACCATAATAACCG CCTTCGTAGGCTATGTACTGCCCTGAGGACAAATATCATTTTGAGGGGCAACCGTAATCACTAACCTC CTTTCCGCCTTCCCGTACATCGGCGACACATTAGTGCAATGAATCTGAGGCGGCTTTTCAGTC