Upon aligning the two sequences you would get the results below.
A vertical line indicates that the base is conserved in the two sequences, the absence of a line indicates a change. This makes it easy to identify conserved regions which would be good sites for a primer to bind to both sequences.
There are many possible answers to this problem. The two below are not necessarily the best, try several primer sequences to see which work best.
The sequence ccttggcctctgcct would make a good first primer. There is only one mis-match. However, it only has a Tm of 54oC and forms a hairpin and dimers.
Instead, the sequence gccttctcctccgtcgccc is 74% GC with a Tm of 63oC and doesn«t form hairpins or dimers. This would be a better primer, but the PCR product would be about 100 bp shorter. This would make a decent Primer 1.
Similarly the sequence cgatgtaggggaaggcggaaag
is 59% GC with a Tm of 61oC and doesn«t form
hairpins or dimers. This would make a good Primer 2.