You are currently viewing an archived version of this material. 
For the current Biology Student Workbench Project please visit 
BioQUEST/bioinformatics or Biology Student Workbench

Off-site linksóthose that require an Internet connectionóare highlighted (e.g., BioQUEST.org).

This exercise is also available from the author at the GenWeb site.

Return to the BSW Module Index

Generation of Phylogenetic Tree based upon DNA sequence analysis

by Scott Cooper (University of WisconsinóLa Crosse, cooper@mail.uwlax.edu)

Exercise:

There are two steps to creating a phylogenetic tree:


Using Biology WorkBench to align two or more sequences.

First we will align DNA sequences from the Mitochondrial D-loop from five species (Human, Chimp, Gorilla, Orangutan and Neanderthal).   These sequences can be found at the site Primates.  They have also been pasted below.

Log onto the Biology WorkBench, (also see Scott Cooper's information about the Biology WorkBench)
select Session Tools and create a new session named phylo.

Select  Nucleic Tools and then scroll down to Add New Sequence.

Create files for each species and paste in the mitochondrial D-loop sequence.

Select the sequences that you wish to align by clicking the box next to each file, and then select CLUSTALW.

Phylo1

You will now be given some options on parameters you can change in your alignment.  You can just use the default values and select Submit at the bottom of the page.

The results will show the five sequences with colored letters representing a consensus.  Black letters will illustrate a mismatch and dashes will represent gaps.

Phylo2
 

Select Import Alignment(s). This will save this alignment in a single file for further analysis.
 
 

Using Biology WorkBench to create a phylogenetic tree.

Next select Alignment Tools select the aligned sequences by clicking the box next to the file name.

Next click either the button DRAWTREE or DRAWGRAM.

DRAWTREE draws a rooted tree.

DRAWGRAM draws an unrooted tree.

You will now be given some options on parameters you can change in your alignment.  You can just use the default values and select Submit at the bottom of the page.

The tree will now appear.

Congratulations you are now an evolutionary biologist.
 
 

Analysis of trees

Examine your tree.

As a further exercise you could try this analysis with 4-5 other species of your choosing.
 
 

Example D-loop hypervariable regions from five primate species.

>gi|2286205|gb|AF011222.1| Homo sapiens neanderthalensis mitochondrial D-loop hypervariable region 1
GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTATCTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACC ATAATTACTTGACTACCTGCAGTACATAAAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACA ACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTT CTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGAT

>neanderthal_2000
CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGTAATACATAAAAAC CTAATCCACATCAACCCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTACACCCACTAGGATAT CAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGG GTCCCTTGA

>gi|975204|emb|X90314.1|MTHSWGICB H.sapiens mitochondrial DNA for D-loop (isolate WG+ice37+B)
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCA TAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAA CTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCT CGTCCCCATGGATGACCCCCCTCA

>gi|3766221|gb|AF089820.1|AF089820 Gorilla gorilla beringei mitochondrial D-loop, partial sequence
TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATGTCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCA CAAACACTCCCCCACCTATAATACATTACCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTACATAATACATAAAAT CATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCCCCTTCAGATAGGGATCCCTTAAACACCATCCTCCGTGAAATCAATATCCCGCACAA GAGTGCTACTCTCCTCGCTCCGGGCCCATAACACCTGG

>gi|6288860|gb|AF176766.1|AF176766 Pan troglodytes troglodytes isolate DODO mitochondrial D-loop, partial sequence
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAACCACTCAACTACCTATAATACAT TAAGCCCACCCCCACATTACAACCTCCACCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACACCCCTCTCCCACCCC GATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCGCACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGA TAGG

>gi|1743293|emb|X97708.1|MIPACONTR P.abelii (YN91-227) mitochondrial DNA for control region
TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCGTACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAA TCGCTTAACCAACTATAATGCATACAAAACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACACATACACCGATCTC TCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTACATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCC CCACGGATGCCCCCCCTCAGTTAGTAATCCCTTACTCACCATCCTCCG
 

Expected Results