Version 3.2

CLUSTALW
Multiple Sequence Alignment

Selected Sequence(s)
  • Homosapiens
  • Pttroglodytes
  • Ptschweinfurthii
  • Ptversus


    Fasta label (*)Workbench label
    HomosapiensHomosapiens
    PttroglodytesPttroglodytes
    PtschweinfurthiiPtschweinfurthii
    PtversusPtversus

    (*) Clustalw cuts off Fasta labels after the first space (e.g. ">abc def" becomes ">abc").


    Sequence alignment

    Consensus key (see documentation for details)
    * - single, fully conserved residue
      - no consensus
    
    
    CLUSTAL W (1.81) multiple sequence alignment
    
    
    Ptschweinfurthii      ------------------------------------------------------------
    Pttroglodytes         ------------------------------------------------------------
    Ptversus              ------------------------------------------------------------
    Homosapiens           AGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGT
    
    
    Ptschweinfurthii      -----TAGCCCATAAAGGCTGTTGCTATGGTTGTGA-GCAAGAGGATGATGCCA-ATGTT
    Pttroglodytes         -----TAGCCCATAAAGGCTGTTGCTATGGTTGTGA-GCAAGAGGATGATGCCA-ATGTT
    Ptversus              -----TAGCCCATAAAGGCTGTTGCTATGGTTGTGA-GCAAGAGGATAATGCCA-ATGTT
    Homosapiens           TCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTT
                                *  *     *****  *     *   **    *      *  ** *   *  **
    
    Ptschweinfurthii      TCAGGTT-TCTAGG--TAGAGAAATG-AGCCGTAATA-TAGGCCTCGACCGATG--TGTA
    Pttroglodytes         TCAGGTT-TCTAGG--TAGAGAAATG-AGCCGTAATA-TAGGCCTCGACCGATG--TGTA
    Ptversus              TCAGGTT-TCTAGG--TAGAGAAATG-AGCCGTAATA-TAGACCTCGGCCGATG--TGTA
    Homosapiens           TCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCA
                          ***  *  *** *   *  *  * ** **** **  *  *  ** *  ** **   ** *
    
    Ptschweinfurthii      GGAAGAGGCAGATAAAAAATATTGAGGCGCCAT-TAGCGTGAAGGTAGCGG-ATGATCCA
    Pttroglodytes         GGAAGAGGCAGATAAAAAATATTGAGGCGCCAT-TGGCGTGAAGGTAGCGG-ATGATCCA
    Ptversus              GGAAGAGGCAGATAAAAAATATTGAGGCGCCGT-TAGCGTGGAGGTAGCGG-ATGNTCCA
    Homosapiens           CGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCATCTTCCA
                           ***  ** *   ** **      ***   *   *  * *   * **     **  ****
    
    Ptschweinfurthii      ACCATAGTTTACG-T---------------------------------------------
    Pttroglodytes         GCCATAGTTTACG-TCTC------------------------------------------
    Ptversus              ACCATAGTTTACG-TCTCGGGTGATGTGGGCGATCGACGAGAAGGCGGTTGAGGC-----
    Homosapiens           CCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGAC
                           ** ** *  **  *                                             
    
    Ptschweinfurthii      ------------------------------------------------------------
    Pttroglodytes         ------------------------------------------------------------
    Ptversus              ------------------------------------------------------------
    Homosapiens           ATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCC
    
    
    Ptschweinfurthii      ------------------------------------------------------------
    Pttroglodytes         ------------------------------------------------------------
    Ptversus              ------------------------------------------------------------
    Homosapiens           CTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCT
    
    
    
    

    Clustal W dendrogram



    Unrooted tree (generated by Phylip's Drawtree)




    Rooted tree (generated by Phylip's Drawgram)




    Phylip-format dendrogram

    (
    (
    Ptversus:0.02653,
    Homosapiens:0.88172)
    :0.00680,
    Ptschweinfurthii:0.00255,
    Pttroglodytes:0.00868);
    
    

    Clustal W options and diagnostic messages

    Alignment type: Nucleic                 Alignment order: aligned                
    
                        Pairwise alignment parameters
    
    Method: accurate                        
    Matrix: IUB                             
    Gap open penalty: 15.00                 Gap extension penalty: 6.66             
    
                        Multiple alignment parameters
    
    Matrix: IUB                             Negative matrix?: no                    
    Gap open penalty: 15.00                 Gap extension penalty: 6.66             
    % identity for delay: 30                DNA transitions weighting: 0.5          
    
    
    
    
     CLUSTAL W (1.81) Multiple Sequence Alignments
    
    
    
    Sequence type explicitly set to DNA
    Sequence format is Pearson
    Sequence 1: Ptversus              218 bp
    Sequence 2: Ptschweinfurthii      178 bp
    Sequence 3: Pttroglodytes         181 bp
    Sequence 4: Homosapiens           420 bp
    Start of Pairwise alignments
    Aligning...
    Sequences (1:2) Aligned. Score:  96
    Sequences (1:3) Aligned. Score:  95
    Sequences (1:4) Aligned. Score:  9
    Sequences (2:3) Aligned. Score:  98
    Sequences (2:4) Aligned. Score:  10
    Sequences (3:4) Aligned. Score:  10
    Time for pairwise alignment: 0.026714
    
    Guide tree        file created:   [../tmp-dir/29565.CLUSTALW.dnd]
    Start of Multiple Alignment
    There are 3 groups
    Aligning...
    Group 1: Sequences:   2      Score:3361
    Group 2: Sequences:   3      Score:3351
    Group 3:                     Delayed
    Sequence:4     Score:1655
    Time for multiple alignment: 0.132071
    
    Alignment Score 4450
    CLUSTAL-Alignment file created  [../tmp-dir/29565.CLUSTALW.aln]
    
    

    Citation


    Copyright (C) 1999, Board of Trustees of the University of Illinois.