Bioinformatics Education Dissemination: Reaching Out, Connecting and Knitting-together

Chimpanzee Sequence Data

>Pt verus (Tai Forest, Ivory Coast) gi|556039|gb|L35432.1|CHPMTACR Pan troglodytes mitochondrial DNA, 3' end of control region
TACCACCTAAGTACTGGCTCATCCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAATTACCCAACTACCTATAACACATAAAACCCACCCCACATTAAAGCCTTCACCCCATGCTTACAAGCACGCACAACAATCAACCTCTAACTNTCAAACATAAAACACAACTCCAACGACACTTCTCCCCCACCCCGATACCAACAAACCTACCCCCCCTTGACAAAACATAGTACATACAATCACACACCGTACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGATCCCCCTCA

>Pt verus (Tai Forest, Ivory Coast) gi|556042|gb|L35433.1|CHPMTBCR Pan troglodytes mitochondrial DNA, 3' end of control region
CCTAAGTACTGGCTCATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAATCACCCAACTACCTATAACACATAAAATCCACTCCCACACCAAAACCTTCACCCCATGCTTACAAGCACGCACAACAATCAACCTCCAACTGTCGAACATAAAACACAACTCCAACGACACCCCTCCCCCACCCCGATATCAACAGACCTACCCCCCTTGACAGAACATAGTACATACAATCATACACCGTACATAGCACATTACAGTCAAATTCTTCCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAAT

>Pt schweinfurthii (Ruhara, Burundi) gi|556045|gb|L35434.1|CHPMTCCR Pan troglodytes mitochondrial DNA, 3' end of control region
TTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAACCTCCACCCTATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATACCAACAGACCTATACTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania)gi|556048|gb|L35380.1|CHPMTCRA Pan troglodytes mitochondrial DNA, 3' end of control region
ACCACCTAAGNNNNNGCTTATTCATTACAACCGCTATGTACTTTGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACTCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt verus (Mali) gi|556049|gb|L35406.1|CHPMTCRAA Pan troglodytes mitochondrial DNA, 3' end of control region
GGCTCATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAATCACCCAACTACCTATAACACATAAAATCCACTCCCACACCAAAACCTTCACCCCATGCTTACAAGCACGCACAACAATCAACCTCCAACTGTCGAACATAAAACACAACTCCAACGACNNNNNNNNNNCACCCCGATATCAACAGACCTACCCCCCCCTGACAGAACATAGTACATACAATCATACACCGTACATAGCACATTACAGTCAAATTCTTCCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAAT

>Pt verus (Mali) gi|556050|gb|L35407.1|CHPMTCRAB Pan troglodytes mitochondrial DNA, 3' end of control region
GGCTCATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAATCACCCAACTACCTATAGCACATAAAACCCACCCCACATTAAAACCTTCACCCCATGCTTACAAGCACGCACAACAATCAACCTCTAACTATCAAACATAAAACACAACTCCAACGACACCTCTCCCCCACCCCGATACCAACAAACCTACCCCCCTTGACAAAACATAGTACATACAATCACACACCGTACATAGCACATTACAGTTAAATCCATCCTTGCCCCCACGGATGATCC

>Pt verus (Mali) gi|556051|gb|L35408.1|CHPMTCRAC Pan troglodytes mitochondrial DNA, 3' end of control region
GGCTCATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAATTACCCAACTACCTATAACACATAAAACCCACCCCACATTAAAACCTTCACCCCATGCTTACAAGCACGCACAACAATCAACCTCTAACTATCAAACATAAAACACAACTCCAACGACACTTCTCCCCCACCCCGATACCAACAAACCTACCCCCCCTTGATAAAACATAGTACATACAATCACACACCGTACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGATCC

>Pt schweinfurthii (Zaire, Chimfunshi Wildlife Orphanage) gi|556052|gb|L35409.1|CHPMTCRAD Pan troglodytes mitochondrial DNA, 3' end of control region
GCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTNCTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCATCCCGATATCAACAAACCTATCCTCCCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt troglodytes (Gabon, from CIRMF) gi|556053|gb|L35410.1|CHPMTCRAE Pan troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATTAAACCCACTCCACATTACAACGTCCCCCCCATGCTTACAAGCATGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGGCATTCCTCCCCCACCCCGATACCAACAAACTTACACTCCCTTAACAGCACATAGCACATACAACCGCACACCAGACATGGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGGAG

>Pt schweinfurthii (Gombe National Park, Tanzania) gi|556054|gb|L35411.1|CHPMTCRAF Pan troglodytes mitochondrial DNA, 3' end of control region
AGTACCACCTAAGTATTGGCTTACTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Tongwe Forest, Tanzania) gi|556055|gb|L35412.1|CHPMTCRAG Pan troglodytes mitochondrial DNA, 3' end of control region
ATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCTTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGC

>Pt schweinfurthii (Mahale, Tanzania) gi|556056|gb|L35413.1|CHPMTCRAH Pan troglodytes mitochondrial DNA, 3' end of control region
ATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Tongwe Forest, Tanzania) gi|556057|gb|L35414.1|CHPMTCRAI Pan troglodytes mitochondrial DNA, 3' end of control region
TACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCTTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCNCCCACGGATGCC

>Pt schweinfurthii (Tongwe Forest, Tanzania) gi|556058|gb|L35415.1|CHPMTCRAJ Pan troglodytes mitochondrial DNA, 3' end of control region
ATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCTTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGC

>Pt schweinfurthii (Tongwe Forest, Tanzania) gi|556059|gb|L35416.1|CHPMTCRAK Pan troglodytes mitochondrial DNA, 3' end of control region
TATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCTTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Kinyonzo, Zaire) gi|556060|gb|L35417.1|CHPMTCRAL Pan troglodytes mitochondrial DNA, 3' end of control region
ATTANNNNNGCTATGTACTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGNNCTACAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATACCAACAGACCTATACTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Ruti, Uganda) gi|556061|gb|L35418.1|CHPMTCRAM Pan troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGNNTTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCNNTACCCCATGCTTACAAGCATGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGTTACCAACAAACCTGTACTCCCTTTTCTGTACATAGTACATACAANCGTACACNATACATAGCACATTACAGTCAAATCCATCCTCGGCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Mahale, Tanzania) gi|556062|gb|L35419.1|CHPMTCRAN Pan troglodytes mitochondrial DNA, 3' end of control region
ATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Mahale, Tanzania) gi|556063|gb|L35420.1|CHPMTCRAO Pan troglodytes mitochondrial DNA, 3' end of control region
GCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGNACANNNCTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCTTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Mahale, Tanzania) gi|556064|gb|L35421.1|CHPMTCRAP Pan troglodytes mitochondrial DNA, 3' end of control region
TATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATANTCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTNNAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Tongwe Forest, Tanzania) gi|556065|gb|L35422.1|CHPMTCRAQ Pan troglodytes mitochondrial DNA, 3' end of control region
GTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCTTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTGGGCNNCACGGATGNNNCC

>Pt troglodytes (Lake Telle, Congo) gi|556066|gb|L35423.1|CHPMTCRAR Pan troglodytes mitochondrial DNA, 3' end of control region
AGTACCACCTAAGTATTNGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGTCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAAACCCACTCCACATTACAACGTCCCCCCCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTATAGTCAAATCCATTCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAGT
>Pt troglodytes (Lake Telle, Congo) gi|556067|gb|L35424.1|CHPMTCRAS Pan troglodytes mitochondrial DNA, 3' end of control region
CTAAGNNNNNGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGTCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAAACCCACTCCACATTACAACGTCCCCCCCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTATAGTCAAATCCATTCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAGT

>Pt troglodytes (Lake Telle, Congo) gi|556068|gb|L35425.1|CHPMTCRAT Pan troglodytes mitochondrial DNA, 3' end of control region
ATGTATTTNGNANATTANTGNNAGNNANNATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATCAAACCCACTCCACATTACAATGTCCCCCCCATGCTTACAAGCATGTACAGCAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGACACTCCTCCCCCACCCTGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTACAGTCAAATCCATTCTCGTCCCCACGGATGCCCCCCCTCAGATGGGAGT

>Pt troglodytes (Lake Telle, Congo) gi|556069|gb|L35426.1|CHPMTCRAU Pan troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATNGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATTAAACCCACCCCCCACATTACAACCTCCACCCTATGCTTACAAGCACGCACAACAGTCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACACCCCTCCCCCACCCCGATACCAACAAACCTATACCCCCTTAACAGTACATAGTACATACAACCGTACATCGCACATAGCACATTACAGTCAAATCCATCCTTGTCCCCACGGATGCCCCCCCTCAGATAGGAG

>Pt troglodytes (Lake Telle, Congo) gi|556070|gb|L35427.1|CHPMTCRAV Pan troglodytes mitochondrial DNA, 3' end of control region
AGTACCACCTAAGTATNGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACCCAACTACCTATAACACATTAAACCCACCCCACATTACAACGTCCCCCCCATGCTTACAAGCACGCACAACAATCAGCCCTCAACTGTCACACATAAAATGCAACTCCAAAGACACTCCTCCCCCTCCCCGATACCAACAGACCTGCACCCCCTTAATAGTACATAGCACATACAACCGCACACCAGACATGGCACATTACAGTCAAACCCATTCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAGT

>Pt troglodytes (Nyanga, Gabon, from CIRMF) gi|556071|gb|L35428.1|CHPMTCRAW Pan troglodytes mitochondrial DNA, 3' end of control region
CTAAGNNNNNGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACCCAACCACCTATAATACATTAAACCCACCCCACATTACAACGTCCACCCCATGCTTACAAGCATGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGTCATTCCTCCTCCACCCTGATACCAACAAACCTATACTCCCTTAACAGTACATAGTACATACAACCGCACATCACACATAGCACATTACAGTCAAATCCGTCCTCGCCCCCACGGATGCCCCCC

>Pt troglodytes (Gabon, from CIRMF) gi|556072|gb|L35429.1|CHPMTCRAX Pan troglodytes mitochondrial DNA, 3' end of control region
GCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAAACCTACTCCACATTACAACGTCCCCCCCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAGACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTGTAGTCAAATCCATTCTCGTCCCCACGGATGCC

>Pt troglodytes (Equatorial Guinea, from CIRMF) gi|556073|gb|L35430.1|CHPMTCRAY Pan troglodytes mitochondrial DNA, 3' end of control region
ATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAANCCCACCCCACATTACAACGNCCCCCCCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAGACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTTCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTACAGTCAAATCCATTCTCGTCCCCACGGATGCCCCCCCNNNNNTAGGAGT

>Pt verus (Tai Forest, Ivory Coast) gi|556074|gb|L35431.1|CHPMTCRAZ Pan troglodytes mitochondrial DNA, 3' end of control region
TACCACCTAAGTACTGGCTCATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAATCACCCAACTACCTATAATACATAAAATCCACTCCCACACCAAAACCTTCACCCCATGCTTACAAGCACGCACAACAATCAACCTCCAACTGTCGAACATAAGACACAACTCCAACGACACCCCTCCCCCACCCCGATATCAACAGACCTACCCCTCCCTGACAGAACATAGTACATACAATCATACACCGTACATAGCACATTACAGTCAAACTCTTCCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAAT

>Pt schweinfurthii (Gombe, Tanzania) gi|556075|gb|L35381.1|CHPMTCRB Pan troglodytes mitochondrial DNA, 3' end of control region
TCATTACAACCGCTATGTACTTTGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACTCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt troglodytes (CIRMF, Cameroon) gi|556076|gb|L35382.1|CHPMTCRC Pan troglodytes mitrochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATTAAACCCACCCCCACATAACAACCTCCACCCTATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCGCACATAAAATGCAACTCCAAAGACACCTCTCTCCCACCCCGATACCAACAAACCTATACCTTTTTAACAGTACATAGTACATACAACCGTACATCGCACATAGCACATTACAGTCAAATCCATCCTTGTCCCCACGGATGCCCCCCCTCAGATAGGAG

>Pt schweinfurthii (Gombe, Tanzania) gi|556077|gb|L35383.1|CHPMTCRD Pan troglodytes mitochondrial DNA, 3' end of control region
CATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCATTCAACTACCTATAATACATCAAACCCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTATACCCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCANGGATGCCCCCCCTCAGATAGGGNT

>Pt schweinfurthii (Gombe, Tanzania) gi|556078|gb|L35384.1|CHPMTCRE Pan troglodytes mitochondrial DNA, 3' end of control region
TCATTACAACCGCTANGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGNNCTATANTCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCTACCCCATGCTTNCAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACTACTCCAAAGACATTCCTCCCCCACCCCGATACCAACAGACCTGTACTCCCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCANATAGGGGT

>Pt verus (CIRMF, Gabon) gi|556079|gb|L35385.1|CHPMTCRF Pan troglodytes mitochondrial DNA, 3' end of control region
CATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTNNNNNNNNNTATANTCACCCAACTACCTNTAACACATAAAATCCACTCCCACACCAAAACCTTCACCCCATGCTTACAAGCACGCACAACAATCAACCTCCAACTGTCGAACATAAAACACAACTCCAACGACACCCCTCCCCCACCCCGATATCAACAGACCTACCCCCCCTTGANAGAACATAGTACATACAATCATACACCGTACATAGCACATTACAGTCAAATTCTTCCTCNTCCCCNC

>Pt schweinfurthii (Gombe, Tanzania) gi|556080|gb|L35386.1|CHPMTCRG Pan troglodytes mitochondrial DNA, 3' end of control region
TACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCATTCAACTACCTATAATACATCAAACCCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTATACCCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGG

>Pt schweinfurthii (Gombe, Tanzania) gi|556081|gb|L35387.1|CHPMTCRH Pan troglodytes mitochondrial DNA, 3' end of control region
TACCACCTAAGTATTGGCTTATTCGTTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACTCCAATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTATAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt troglodytes (CIRMF, Gabon) gi|556082|gb|L35388.1|CHPMTCRI Pan troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAGCACATTAAACCCACTCCACATTACAACGTCCCCCCCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTATAGTCAAATCCATTCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAG

>Pt schweinfurthii (Chimfunshi Wildlife Orphanage) gi|556083|gb|L35389.1|CHPMTCRJ Pan troglodytes mitochondrial DNA, 3' end of control region
ACCTAAGNNNNNGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATACCAACAGACCTATACTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Chimfunshi Wildlife Orphanage) gi|556084|gb|L35390.1|CHPMTCRK Pan troglodytes schweinfurthii mitochondrial DNA, 3' end of control region
CATTACAANCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATCATAACCTCTACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATACCAACAGACCTGTACTCCCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556085|gb|L35391.1|CHPMTCRL Pan troglodytes schweinfurthii mitochondrial DNA, 3' end of control region
GCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCATTCAACTACCTATAATACATCAAACCCACCCCACATCACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACATCATACATAGCACATTACAGTCAAATCCATTCTCGCCCCCACGGATGCNNCCNNNNNNNGAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556086|gb|L35392.1|CHPMTCRM Pan troglodytes schweinfurthii mitochondrial DNA, 3' end of control region
AGTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCCACCCTATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATACCAACAGACCTACACTCCCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt troglodytes (CIRMF, Ogooue-Ivindo, Gabon) gi|556087|gb|L35393.1|CHPMTCRN Pan troglodytes schweinfurthii mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAAATCCACTCCACATTACAATGTCCCCCCCCCGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAGACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTACAGTCAAATCCATTCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAG

>Pt schweinfurthii (Gombe, Tanzania) gi|556088|gb|L35394.1|CHPMTCRO Pan troglodytes schweinfurthii mitochondrial DNA, 3' end of control region
CTAAGNNNNGGCTTACTCATTACANCCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCNCGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556089|gb|L35395.1|CHPMTCRP Pan troglodytes schweinfurthii mitochondrial DNA, 3' end of control region
ACCTAAGNNNNNNCTTATTCGTTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCCACCCCATGCTTACAAGCACGCANNNCAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACTCCAATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTATAGTCAAATCCATCCTCGCCCCCACGGATGC

>Pt schweinfurthii (Chimfunshi Wildlife Orphanage) gi|556090|gb|L35396.1|CHPMTCRQ Pan troglodytes schweinfurthii mitochondrial DNA, 3' end of control region
GCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGNACTATAATCACTCAACTACCTATAATACATCAAATCCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATACCAACAAACCTATACTCTTTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATTCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt troglodytes (CIRMF, Ogooue-Ivindo, Gabon) gi|556091|gb|L35397.1|CHPMTCRR Pan troglodytes troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAAACCCACCCCACATTACAACGTCCCCCTCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAGACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATAGCACATTACAGTCAAATCCATTCTCGTCCCCACGGATGCCCCCCCTCAGATAGGAGT

>Pt troglodytes (Burundi) gi|556092|gb|L35398.1|CHPMTCRS Pan troglodytes troglodytes mitochondrial DNA, 3' end of control region
CATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTACAGCCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCTTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCTGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556093|gb|L35399.1|CHPMTCRT Pan troglodytes from mitochondrial DNA, 3' end of control region
TCATTACAACCGCTATGTACTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTNCCTATAATACATCAAACTCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt troglodytes (CIRMF, Haut-Ogooue, Gabon) gi|556094|gb|L35401.1|CHPMTCRTV Pan troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAAACCCACCCCACATTACAACGTCCCCCCCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGCACATACAACCGCACACCAGACATGGCACATTACAGTCAAATCCATTCTCGCCCCCACGGATGCCCCCCCTCAGATAGGAG

>Pt troglodytes (CIRMF, Cameroon) gi|556095|gb|L35400.1|CHPMTCRU Pan troglodytes mitochondrial DNA, 3' end of control region
GNACCACCTAAGNNNNNGCCTATTCATTACANCCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACCCAACTACCTATAATACATTAAACCCACCCCTTACATTACAACCTCCACCCTATGCTTACAAGCNCNCACAACAATNNNNNCCCAACTGTCACACATAAAATGCAACTCCAAAGACACTCCTNNCCCACCCCGATACCAACAAACCTATACCCCCTTAACAGCGCATAGTACATACAACCGTACATCGTACATAGCACATCGCAGTCAAATCCATCCTTGTCCCCACGGATGCCCCCCCTCAGATAGGGGT
>Pt troglodytes (CIRMF, Ngounie, Gabon) gi|556096|gb|L35402.1|CHPMTCRW Pan troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAACACATTAAACCCACTCCACATTACAACGTCCCCCCCATGCTTACAAGCACGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTACACTCCCTTAACAGTACATAGTACATACAACCGCACACCAGACATAGCACATTATAGTCAAATCCATTCTCGTCCTCACGGATGCCCCCCCTCAGATAGGAGT

>Pt verus (North Carolina Zoological Park) gi|556097|gb|L35403.1|CHPMTCRX Pan troglodytes mitochondrial DNA, 3' end of control region
ANNTAAGNNNNNGNTNATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAATCACCCAACCACCTATAGCACATAAAATCCACCTCACATTAAAACCTTCACCCCATGCTTACAAGCACGCACAACAATCANCCCCCAACTATCGAACATAAAACACAACTCCAACGACACTTCTCNCCCACCCTAATACCAACAAACCTACCCTCCCTTGACAAAACATAATACATACAATTACACACCGTACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGATCCCCCTCAGATGGGAAT

>Pt schweinfurthii (Zaire, Chimfunshi Wildlife Orphanage) gi|556098|gb|L35404.1|CHPMTCRY Pan troglodytes mitochondrial DNA, 3' end of control region
GTTACAANCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACCCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCAATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTATAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCTTCAGATAGGGGT

>Pt troglodytes (CIRMF, Haut-Ogooue, Gabon) gi|556099|gb|L35405.1|CHPMTCRZ Pan troglodytes mitochondrial DNA, 3' end of control region
GTACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACCCAACCACCTATAATACATTAAACCCACCCCACATTACAACGTCCACCCCATGCTTACAAGCATGTACAACAATCAACCCTCAACTGTCACACATAAAACGCAACTCCAAAGTCATTCCTCCTCCACCCTGATACCAACAAACCTATACTCCCTTAACAGTACATAGTACATACAACCGCACATCACACATAGCACATTACAGTCAAATCCGTCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556152|gb|L35435.1|CHPMTDCR Pan troglodytes mitochondrial DNA, 3' end of control region
TACAACCGCTATGTACTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTANAATCACTCAACTACCTATAATACATCAAACTCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556155|gb|L35436.1|CHPMTECR Pan troglodytes mitochondrial DNA, 3' end of control region
GCTTATTCATTACAACCGCTANGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCATTCAACTACCTATAATACATCAAACTCACCCCACATCACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACATCATACATAGCACATTACAGTCAAATCCATTCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556158|gb|L35437.1|CHPMTFCR Pan troglodytes mitochondrial DNA, 3' end of control region
TACCACCTAAGTATTGGCTTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCATTCAACTACCTATAATACATCAAACCCACCCCACATCACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACATCATACATAGCACATTACAGTCAAATCCATTCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556161|gb|L35438.1|CHPMTGCR Pan troglodytes mitochondrial DNA, 3' end of control region
AAGNNNNNNNNNATTCATTACAACCGCTATGTACTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCACTCAACTACCTATAATACATCAAACTCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCGATATCAACAAACCTATCCTCTCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556164|gb|L35439.1|CHPMTHCR Pan troglodytes mitochondrial DNA, 3' end of control region
CATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAATCATTCAACTACCTATAATACATCAAACCCACCCCACATTACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTATACCCTCTTAACAGTACATAGCACATACAACCGTACACCATACATAGCACATTACAGTCAAATCCATCCTCGCCNNNACGGATGCCCCCCCTCAGATAGGGGT

>Pt verus (Chimfunshi Wildlife Orphanage, from Liberia) gi|556167|gb|L35440.1|CHPMTICR Pan troglodytes mitochondrial DNA, 3' end of control region
AATACCACCTAAGTACTGGCTCATTCATTACANNCGCTATGTATTTCGTACATTACTGCCAGCCACCATGNATATTGTACGGNNGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACCCACCCCACATTAAAACCTTCACCCCATGCTTNNNAGCACGCACAACAATCAACCTCTAACTATCAAACATAAAACACAACTCCAACGACACTTCNCNNCCACCCCGATACCAACAAACCTACCCCCCCTTGACAAAACATAGTACATACAATCACACACCGTACATAGCACATTACAGTCAAATCCATCCTCGCCCCCACGGATGATCCCCCTCAGATAGGAA
>Pt schweinfurthii (Gombe, Tanzania) gi|556168|gb|L35441.1|CHPMTJCR Pan troglodytes mitochondrial DNA, 3' end of control region
ACCACCTAAGNNTNGGCNNNNTCATTACAACCGCTATGNATTTCGTACATTACTGCCAGCCACCATGANTATTGTACANNNNNNNNNTCATTCAACTACCTATAATACATCAAACCCACCCCACATCACAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACACTCCTCCCCCACCCCGATACCAACAAACCTATACTCTCTTAACAGTACATAGCACATACAACCGTACATCATACATAGCACATTACAGTCAAATCCATTCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pt schweinfurthii (Gombe, Tanzania) gi|556169|gb|L35442.1|CHPMTKCR Pan troglodytes mitochondrial DNA, 3' end of control region
CCACCTAAGNNNNNNCTTATTCGTTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGNACTATAATCACTCAACTACCTATAATACATCAAACCCACCCCACATTATAACCTCCACCCCATGCTTACAAGCACGCACAACAATCAACCCTCAACTGTCACACATAAAACACAACTCCAAAGACATTCCTCCCCCACCCCAGTATCAACAAACCTATCCTCCCTTAACAGTACATAGTACATACAACCGTACACCATACATAGCACATTATAGTCAAATCCATCCTCGCCCCCACGGATGCCCCCCCTCAGATAGGGGT

>Pan paniscus (San Diego Zoo) gi|556170|gb|L35443.1|CHPMTLCR Pan troglodytes mitochondrial DNA, 3' end of control region
TANCCGNTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTATATAGTACTATAATCACTTAACCACCTATAACACATAAAAACCTACATCCACATTAAAACTTTACCCCATGCTTACAAGCACGAACAATAATCAACCTCCAACTGTCAAACATAACACACAACTCCAAAGACACTCCTCCCCCACCCCGATATCAACAAACCTGACAATCCTTGATAGTACATAGTACATACAGTCATATACCGTACATAGCACATTACAGTCAAATCCATTCTCGCCCCCACGGATGCCCCCCCTCNNNNAGGGGT

Copyright ©1988-2015     BioQUEST, Inc.     Madison, WI 53744   (608) 363-2012 All Rights Reserved.